TABLE 2

Primers and probe sequences for real-time PCR

GeneForward primerReverse primerTaqMan probe
HSP725′ CCAAGCAGACGCAGATCTTC 3′5′ GCCCTCGTACACCTGGATCA 3′5′ CCTACTCCGACAACCAACCCGGG 3′
HO-15′ TTCTCCGATGGGTCCTTACACT 3′5′ TCACATGGCATAAAGCCCTACA 3′5′ CAACTGTCGCCACCA 3′
PPAR-γ5′ AAACTTCAAGAGTACCAAAGTGCAA 3′5′ GGCTTATTGTAGAGCTGAGTCTTCTC 3′5′ CAAAGTGGAGCCTGCATCTCCACCTTATT 3′
PPAR-α5′ AGCTTTGGCTTTACGGAATACCA 3′5′ CCACAGGATAAGTCACCGAGGA 3′5′ TCACGGACACGCTTTCACCAGCTTC 3′
GLUT45′ CCTGCCAGAAAGAGTCTGAAGC 3′5′ ATCCTTCAGCTCAGCCAGCA 3′5′ CAGAAACATCGGCCCAGCCTGTCA 3′