TABLE 2

Sequences of each primer pair and their location in sequences cited in GenBank

Sense primerAntisense primerAmplicon size (bp)GenBank accession no.
Conventional RT-PCR primers
  HK-ICAACAGTGTGAAGTCGGCCTCTCTGTCAAACTCGGTTCGG175NM_012734
  GLUT-3TGTTCGCTGTTACTGTTGCCCACACATAACGACCAGAGCG170NM_017102
  MCT-1ATGTTGTCCTGTCCTCCTGGCTCCGCTTTCTGTTCTTTGG172D63834
  MCT-2TTCTTGCTGTCTGTGATGGCAACACGACTATCCCACTGGC395X97445
  LDH-AGGCAACCCTTAAGGAAAAGCCTTCCAAGACATCCACCAGG314NM_012595
  LDH-BTAAGGAAGAACAGGTCCCCCTGAAGATGTTCACGTTTCGC167NM_017025
  Lepr-bCCATTCCCAGCTCACTGTCTGAACAGGATTGAAACTGGGG137D84551
  GADCTGCTTCCAGCTAAGAACGGGGATCTGCTCCAGAGACTCG198NM_017007
  GFAPCCATGGTCCTACCAGACACCACACAGCCAGGTTGTTCTCC443L27219
  β-ActinCCGTAAAGACCTCTATGCCAAAGAAAGGGAAAAGCCA300V01217
Multiplex RT-PCR primers   for first and second   amplifications
  GK
    1stCCTGAAGAAGGTGATGAGCCAGGGAAGGAGAAGGTGAAGC373NM_012565
    2ndGATGCAGAAGGAGATGGACCGGTTCCTCCCAGGTCTAAGG139
  GKRP
    1stGTCGTCATAGGCATCTCTGTGGCTGGTTGGTGAGTTCATCCTTC624NM_013120
    2ndATCCTGAGGACATTTGAGCGTGTGGATGCACTCTACTCCG172
  GLUT2
    1stAAGGATCAAAGCCATGTTGGGGAGACCTTCTGCTCAGTCG502NM_012879
    2ndTGCTGGAAGAAGCGTATCAGGGCCAAGTAGGATGTGCCAG206
  GLUT4
    1stTCTTTGAGATTGGTCCTGGCTACTGGGTTTCACCTCCTGC312NM_012751
    2ndGGTTTCTCCAACTGGACCTGTAAACGGCAAATAGAAGGAAGA95
  SGLT-1
    1stCGGGCAGCTCTTTGACTACATCCAAAGGCGGGGTTCAGGCAAAATA661D16101
    2ndCTTCTGGGGACTGATTCTCGCGCTCTTCTGTGCTGTTACG255
  Kir6.2
    1stCGTCACAAGCATCCACTCCTCACCTGCATATGAATGGTGG328X97041
    2ndCCTTTTCTCCATCGAGGTCCTGAAGATGAGGGTTTCTGCC188
  Kir6.1
    1stAGCCACTGACCTTGTCAACCGGAGTCATGAATTGCACCTT402D42145
    2ndCATAGTGATTCTCGAGGGCGAAGGTTTCTCGTCCAGCTCC212
  SUR-1
    1stTGGACCCAGAGAAGAAATGCACAAAGGAGGCAAAGACGC506L40624
    2ndTGAAGCAACTGCCTCCATCGAAGCTTTTCCGGCTTGTCC182
  SUR-2
    1stAGTGGCAACAACCTGAAACCAATGTGGCTAAACCACTGCC377D83598
    2ndTTCTAACCTATCCATGGGCGTTCTAACCTATCCATGGGCG218
  INS-R
    1stCTGAAGGAGCTGGAGGAGTCGATTTCATGGGTCACAGGGC426M29014
    2ndGCCACTACACCCACACTTCCCTTAGCTTCAGGCATGGTCC233
  • GFAP, glial fibrillary acidic protein.