APPENDIX

Markers identified from genomic sequence on chromosomes 11 and 20

ChromosomePosition (cM)MarkerHeterozygosityPrimer1Primer2Size range (bp)
1180.4D11ms1780.816AGTCCCAGTACGGTTCACTTGATTGTGACAACTTACCCCAC119–144
1180.7D11ms1920.585GTTTCTTCTGCAGTTAAAGGACGCTGACGTGTCTCACAGG234–253
1182.9D11ms2530.608CACCTCAGCAGCCCAAGTGGGTCACTGCAAAAAGAAGTACCC251–283
1183.4D11ms2560.586CACTTCGCTAATTCTTTCCTGGGCCAGCTTGTCCATTTTCT117–129
1183.7D11ms2720.399CATATATGTAACACAGTGCCAGGATGAATCATTAAAGCAATAGTAG165–185
1184.2D11ms2780.681GTGTCTCCCTGCTACAATGTTGAGTCTACCATATGCCAAAC146–167
1184.3D11ms2790.717TCACCATGACAGAAATTGACGCAGTATGTGTGCTTTGAAA86–108
2050.9D20ms30.700ATCAGGGGGCTAGAATGTTTCCGTTTTGGAGGATGGAGTGTAAGA274–290
2050.9D20ms50.755AAAGCCCCTTTAGTAGTCAAAGTCGATCTGACTTGATCAAATCCAGAG193–205
2051.5D20ms310.877CACTATAAGCACTTGGAGACCCACAGTTTGCATATCTGTTTTCCTGTTTAC121–148
2066.8D20ms190.733ACTCCAGGGTGTTTGGCCTGATTTCTCCCTAGCTGCACCAA95–119
2067.1D20ms110.432CTCTGGTTTAGACAAGATGGGAAAGTCCCAAGTATCACAC264–281
2067.3D20ms100.515AATGCATGATTCTTTCAGTACCGTATGGTTATTATTCTTTCAGTACC204–227
2067.3D20ms320.334GGTCAAGATGGCAGATGGGAGCACTGGAGACATATGCCTTC147–154
2067.3D20ms330.177GTGGCAGGGAGATGGTGAATGCCTCTTCAGTCACCTCCCA104–113
2067.5D20ms120.487GGCAGGTGGAGATAAATTATGATGTATGACAGCAACGCC110–165
2068.1D20ms360.727CAAGCAGTCCTCCCACCTCAGCCAATGCCACTTGGTCCTC224–243
2068.4D20ms210.737ATTCTCCTGCCTCACTGTCTCGACAAATCCCTCAGTATGTGGC140–168
2068.9D20ms140.715CATGGCACAGAAGCAAGTAGGCCATCTCTAAAAAAACAGTTATC162–183
2070.9D20ms280.847TGCTTCCCTTCTCCTGAGAAGTACAGACAGACTGAAGTCAAGACCCTGCAT222–263
2070.9D20ms290.801GGTCTAGTTCTTTGCAGAAAGAACAGTCTTTCTACATGCACCTTGCACCCT257–288
2071.7D20ms270.734ATTGTAGAACCTAGGGAATATCAGCGCCAGTAGCAGGTATGGATGCATGT116–137