TABLE 1

Primers and probes for RT-PCR

Gene nameSequenceRef
UCP1
 Forward PCR primerATGACGTCCCCTGCCATTT(16)
 Reverse PCR primerGGAGAGGCCAGGAGTGTGG
 ProbeCTGTCAGCTCTTGTCGCCGGGTTT
GLUT4
 Forward PCR primerTCCATCCCACAAGGCACC(17)
 Reverse PCR primerAATCATGCCACCCACAGAGAA
 ProbeCACTACCCTTTGGGCTCTCTCCGTGG
β3-AR
 Forward PCR primerACTCTGCCTTCAACCCGCT(18)
 Reverse PCR primerAGAAGACGACGGAAGGCGT
 ProbeATCTACTGCCGCAGCCCGGACTTT
Leptin
 Forward PCR primerGGTCACCGGTTTGGACTTCAT(19)
 Reverse PCR primerGGTCTGGTCCATCTTGGACAA
 ProbeCCCGGGCTTCACCCCATTCTG
AGT
 Forward PCR primerGTGACCCTGAGCAGTCCGTT(20)
 Reverse PCR primerAGAAAGTGCAGCGCACCTG
 ProbeTGTTCGCCATCTACGAGCGGGAC
AGTR1A
 Forward PCR primerCACAGTGTGCGCGTTTCATT(21)
 Reverse PCR primerTTGGTAAGGCCCAGCCCTAT
 ProbeTGAGTCTCGGAATTCGACGCTCCC
RPL19
 Forward PCR primerGCTGATCAAAGATGGCCTGAT(22)
 Reverse PCR primerCGGGCCAAGGTGTTCTTC
 ProbeTGACTGTCCATTCCCGGGCTCG
  • All sequences are written 5′ to 3′. Probes are labeled with FAM (5-carboxyfluorescin) or TET (4,7,2′,7′-tetrachloro-6-carboxyfluorescin) (reporter) at 5′ and with TAMRA (6-carboxy-tetramethylrhodamine) (quencher) at 3′ ends. AGTR1A, angiotensin receptor1A.