TABLE 1

Primer sequences

ForwardReverse
hGM-CSFGCAGCCTCACCAAGCTCAAGGGAGGGCAGTGCTGTTTGTAG
hMIP-1αTTTGCTCTGAGAGTTCCCCTGAGCCACTCGGTTGTCACCA
hMCP-1CGCCTCCAGCATGAAAGTCTATGAAGGTGGCTGCTATG
hIL-8ACCGGAAGGAACCATCTCACTGGAAGGCTGCCAAGAGAGC
hLeptinCCTTCCAGAAACGTGATCCAAGGCCAGCACGTGAAGAAGAT
18SGGAGGTCATTGGTGATTACTTTGGAAGAGCCCCAAGGATATTTGACA
  • h, human; IL, interleukin.