TABLE 1

Oligonucleotide sequences for primer/probe sets used Taqman analysis

GeneAccession numberForward primerProbeReverse primer
ND 1CCCTAAAACCCGCCACATCTCCATCACCCTCTACATCACCGCCCGAGCGATGGTGAGAGCTAAGGT
ND 4CCATTCTCCTCCTATCCCTCAACCCGACATCATTACCGGGTTTTCCTCTTGCACAATCTGATGTTTTGGTTAAACTATATTT
LPLNM_000237CGAGTCGTCTTTCTCCTGATGATACATTCACCAGAGGGTCTTCTGGATTCCAATGCTTCGA
PGC-1αNM_013261CACCAAACCCACAGAGAACACGCAGTCACAACACTTACAAGCCAAACGGGTCATTTGGTGACTCTGG
PGC-1βNM_133263CAGCCACTCGAAGGAACTTCACTGAACACGGCCCTCTGCTCTCACACGGATGCTTGGCGTTCTG
mtTFANM_003201CCCAGATGCAAAAACTACAGAACTAATCCAACGCTGGGCAATTCTTCTATCCGCCCTATAAGCATCTTGA
Cyt CNM_001916TGGCCCCTCCCATCTACACAGAGTTTGACGATGGCACCCCAGCTAATCCTTGGCTATCTGGGACATG
NRF-1NM_005011CGTTGCCCAAGTGAATTATTCTGTTGTTCCACCTCTCCATCAGCCACCCTGTAACGTGGCCCAAT
PPAR-αNM_005036GCTTTGGCTTTACGGAATACCAAGCCATCTGAGCCAGGACAGCTTCCTAATGAAAGCGTGTCCGTGATGA
MCADAF251043TGCCCTGGAAAGGAAAACTTTTGTAGAGCACCAAGCAATATCATTTATGGTTCAACTTTCATTGCCATTTCAG
CPT-1D87812CCAGAGCAGCACCCCAATCATCTGCTACAGGGCCAAAGCCACCTCTGCAATCATGTAGGAAACTCCATAG
MLYCDNM_012213TGGCACTGACTGGTGACATCTCAACATCCAGGCAATCGTGAAGGAACATCTGTTCTTCTCTTCTGTTTCTGATGGA
UCP-1NM_021833ACGACACGGTCCAGGAGTTCTCACCGCAGGGAAAGAAACAGCACCACCAGCTAAAATCTTGCTTCCTAAAC
TIF-2NM_006540AGTGACCTCCGTGCCTACGTAGGATCATTAACCTGCTCGGGACCCATCAGGTTGCCTCCCCTCAGA
SRC-1U40396GCAGATGCCAGGAATGAACATGCCCTGAGCAGATAAATGATCCCTTGCAGTAGAGGCCTGTGTGTCT
ADRB3NM_000025CGCAGCCCAGGCTTTAGCCCCGTCGAGCCGTTGCTTCTTGTCCTTCAGGCCTAAG
Cyclophilin BXM_042251GGAGATGGCACAGGAGGAAACATCTACGGTGAGCGCTTCCCCGCGTAGTGCTTCAGTTTGAAGTTCTCA
  • ND, NADH dehydrogenase subunit 1; ND 4, NADH dehydrogenase subunit 4; LPL, liporotein lipase; Cyt C, cytochrome C; TIF-2, nuclear receptor coactivator-2; SRC-1, steroid receptor coactivator-1.