TABLE 1

Primers used for real-time PCR assays of mRNA expression of genes related to lipid metabolism in WAT, liver, and skeletal muscle

GeneAccess no.Forward primerReverse primerAmplicon (bp)
aP2M13385AAGGAAAGTGGCAGGCATGGCACGCCCAGTTTGAAGGAAATC118
C/EBPαBC028890CAAGAACAGCAACGAGTACCAGGCGGTCATTGTCACTG135
PPARαX57638CGGGAAAGACCAGCAACAACTGGCAGCAGTGGAAGAATCG142
PPARγNM011146CGAGGACATCCAAGACAACTGTGACGATCTGCCTGAG124
SREBP1cNM011480CTGGCTGAGGCGGGATGATACGGGCCACAAGAAGTAGA290