TABLE 1

Primer sequences

18S forward5′TTCGAACGTCTGCCCTATCAA3’
18S reverse5′ATGGTAGGCACGGCGACTA3′
MCP-1 forward5′CCCCAGTCACCTGCTGTTAT3’
MCP-1 reverse5′AGGTGACTGGGGCATTGATT3′
CD68 forward5′GCTACATGGCGGTGGAGTACAA3′
CD68 reverse5′ATGATGAGAGGCAGCAAGATGG3′