TABLE 1

Oligonucleotide sequences for PCR

Gene and oligonucleotide sequences
FN
    Human
        GATAAATCAACAGTGGGAGC
        CCCAGATCATGGAGTCTTTA
    Mouse
        CGGTAGGACCTTCTATTCCT
        GATACATGACCCCTTCATTG
    Rat
        CCAGGCACTGACTACAAGAT
        CATGATACCAGCAAGGAGT
p300
    Human/mouse/rat
        GGGACTAACCAATGGTGGTG
        ATTGGGAGAAGTCAAGCCTG
PARP
    Human
        ACACCCCTTGCACGTACTTC
        GATGGGTTCTCTGAGCTTCG
CBP
    Human
        ATGATCTTCCTGATGAGCTG
        AGCCCCACTTGCTTTTGT
β-actin
    Human/mouse
        CCTCTATGCCAACACAGTGC
        CATCGTACTCCTGCTTGCTG