TABLE 1

Sequencing primers used in this study

GenePrimer FPrimer R
Nos2-cDNA-ACCCACGGGACACAGTGTCACTGGTTTTCCTTTGTTACAGCTTCCAGCCTGGC
Nos2-cDNA-BGAGCTCCTGCCTCATGCCATTGAGTTCGGTGCCCATGTACCAACCATTGAAG
Nos2-cDNA-CGCTCGGGTTGAAGTGGTATGCACTGCGTCCATGCAGACAACCTTGGTGTTGAAG
Nos2-cDNA-DGGTCAGAGCCACAGTCCTCTTTGCTACTGAGTAGCTGGGCCCTCGGCTGCC
Nos2-cDNA-ECCATGAGGCTGAAATCCCAGCAGAATCACTGACACTTCGCACAAAGCAGGGC
Nos2-cDNA-FCGAGATGGTCAGGGTCCCCTGCAGTGCCAGAAGCTGGAACTCTGGGC
Nos2 4000-5′ regulatoryCTTCACTGCTGAGTTATCTCACCAGCGTTTTTGGTCAACAGTTGGGAGATTC
Nos2 7000-5′ regulatoryCCTTCGCTTCTAAAGCCATCTTGTCACCTTCCTTAAGGGGCTATGCATTC
Nos2 8000A-5′ regulatoryCCTGTCTACTTCGACCCATAACCACTCGGGTTCAGCCAGGTATGCCTCTAAG
Nos2 8000B-5′ regulatoryGGACAGAGCATTCACCATCTGGTCGAGATCTGACTCCCTATTCTGGAGTGTC