TABLE 1

Primers used for multiplex RT-PCR

Multiplex groupGeneForward primerReverse primerProduct size (bp)Primer conc. (nmol/l)Accession no.
A (28 cycles)
α-tubulinCTCGCATCCACTTCCCTCATGCCCTCACCCACGTAC451100J00797
E6-APACTGGTCCGGCTAGAGATGGTGAGAGTCTCCCAAGTCACG358400NM_011668
UbcH5GTGACCCTCCAGCACAATGGGGGTCATCTGGGTTTGG31140NM_031237
β-TRCPCCAACTGACATCACCCTCAGCCTGTCTCTGTACTGC197400AF112979
B (28 cycles)
CyclophilinAACCCCACCGTGTTCTTCTGCCTTCTTTCACCTTCCC40040M19533
ParkinTCAGAAGCAGCCAGAGGTCTCTGAGGTTGGGTGTGCTC266400AF257234
c-CblAGGTGGTGCGGTTGTGTCGTCTCCTTGGAAGAGTCC338200X57111
Nedd4AGGCTGTTCAGTCGCCTCGCACAGGAAGTGTAGGCTG186100U50842
C (26 cycles)
α-tubulinCTCGCATCCACTTCCCTCATGCCCTCACCCACGTAC451200J00797
Uch-L1AACCCCGAGATGCTGAACGGCTGCCTGAATGGCCTC400100NM_017237
D (23 cycles)
CyclophilinAACCCCACCGTGTTCTTCTGCCTTCTTTCACCTTCCC40040M19533
Poly-Ub ATTTGTGAGGACTGCAGCCTCACAAAGATCTGCATGCC*28040/120D17296
Poly-Ub BTGTGAGGGTGTTTCGACGTCACAAAGATCTGCATGCC*310100/120D16554
  • *

    * As polyubiquitin genes A and B are quite similar, the reverse primer is the same for both. The reverse primer concentration is higher to accommodate both forward primers in the same PCR.