TABLE 1

Primers used for intestinal TJ quantitative genes expression by real-time PCR

GeneSenseAntisense
ZO-1CAAGATAGTTTGGCAGCAAGAGATGATCAGGGACATTCAATAGCGTAGC
OccludinAATTCTTCACTTCTAACAAATGGACCTCCACATCACAATAATGAGCATAGACAGG
Claudin 1TGGTGGTTGGCATCCTCCTGAATTCGTACCTGGCATTGACTGG
Claudin 2GGCGGTAGCAGGTGGAGTCCTTGGTAGGCATCGTAGTAGTTGG
Myosin IXBAGGGTACAGCGCCAAGTACACTCCTTCAGGAAGACCTTGG