TABLE 1

Sequence of primer used in quantitative RT-PCR analysis of MIN6 cells

GeneAccession no.Product size (bp)Forward primerReverse primer
Creb1NM_133828194GCAACCAAGTTGTTGTTCATCTACGACATTCTCTTGCT
Bcl-2NM_009741194CTTAGAAAATACAGCATTGCGGAGGGATGTGCTTTGCATTCTTGG
B2mNM_009735198CGCCTCACATTGAAATCCCTCGATCCCAGTAGACG
  • All sequences are shown from 5′ to 3′.