TABLE 1

Primer sequences used for gene expression analysis by real-time PCR

Gene targetSequences (5′–3′)
F4/80F: CTTTGGCTATGGGCTTCCAGTC
R: GCAAGGAGGACAGAGTTTATCGTG
CD11bF: CGGAAAGTAGTGAGAGAACTGTTTC
R: TTATAATCCAAGGGATCACCGAATTT
CD11cF: CTGGATAGCCTTTCTTCTGCTG
R: GCACACTGTGTCCGAACTC
CD68F: CTTCCCACAGGCAGCACAG;
R: AATGATGAGAGGCAGCAAGAGG
TNF-αF: ATGGCGTTTCCGAATTCAC
R: GAGGCAACCTGACCACTCTC
MCP-1F: ACTGAAGCCAGCTCTCTCTTCCTC
R: TTCCTTCTTGGGGTCAGCACAGAC
IL-6F: TCCAGTTGCCTTCTTGGGAC
R: GTGTAATTAAGCGCCGACTTG
AdiponectinF: GAATCATTATGACGGCAGCA
R: TCATGTACACCGTGATGTGGTA
Cyclophilin BF: ATGTGGTTTTCGGCAAAGTT
R: TGACATCCTTCAGTGGCTTG
  • F, forward; R, reverse.