TABLE 1

Primers used for real-time PCR amplification

GeneGenBank accession no.Primer (5′–3′)PCR product size (bp)
PGC-1αNM_008904Forward: CACCAAACCCACAGAGAACAG Reverse: GCAGTTCCAGAGAGTTCCACA210
CDS2NM_138651Forward: CGGTTCATCTCCTTTGCCC Reverse: GATGACGCACGAGATGGGA201
CPT-1NM_009948Forward: TCACCTGGGCTACACGGAGA Reverse: TCGGGGCTGGTCCTACACTT219
TAZNM_181516Forward: TTGGACGGCTGATTGCTGAG Reverse: TGTGAGGGCTTTCCGCATCT215
ALCATINT_039658Forward: GGAAGTGGAAGGATGATAAG Reverse: GTTTGAGGGATGTTGTAAGG286
CycANM_017101Forward: GAGCACTGGGGAGAAAGGAT Reverse: CTTGCCATCCAGCCACTCAG259
  • CycA, cyclophilin A; TAZ, taffazin.