TABLE 1

Primers used in quantitative real-time PCR

CTGFForward: TAGCCTCAATTTCTGAACAC
Reverse: TTGACGGACTGTCATTCTAT
CPT1β (64)Forward: GAGGCCTCAATGACCAGAATG
Reverse: GTGGACTCGCTGGTACAGGAA
Citrate synthase (64)Forward: TTGGCTGACCTGATACCTAAGG
Reverse: CACCATACATCATGTCCACAGTG
FN (65)Forward: CCTCAATTGTTGTTCGCTGGA
Reverse: GCTACCTTCTACTGATGGCGAATAG
COLIα1 (65)Forward: CCTCAAGGGCTCCAACGAG
Reverse: TCAATCACTGTCTTGCCCCA
COL3α1Forward: TCTCCTGGAAGATTGGTTTA
Reverse: CACCATAACATGCGTCTTTA
TGFβ1 (65)Forward: GCGTGCTAATGGTGGAAACC
Reverse: CGGAGCTCTGATGTGTTGAAGA
PORINForward: CAGTGCCAAATCAAAGCTGA
Reverse: CCTGATGTCCAAGCAAGGTT
COX6Forward: AAGGACGTTGGTGTTGAGGT
Reverse: TTTCTTTGATCAGCCACACG
COX7Forward: GTTTGTACTTTGGATCTGCATT
Reverse: TGGCATATGAGTTCTAGTTTGA
NRF1Forward: TGACATTGGAACAGTGACAT
Reverse: AATGCAGTTTCTTCACCAAT
NRF2Forward: AAATTGAGATTGATGGAACAGAGAA
Reverse: TATGGCCTGGCTTACACATTCA
MtTFAForward: AGATTCCAAGAAGCTAAGGGTGATT
Reverse: TTTCAGAGTCAGACAGATTTTTCCA
PGC1αForward: TTTCCTTTTGCCATGGAATC
Reverse: GAAAGAACCGCTGAACAAGC
PGC1βForward: CTGCATTGATAACAGCCTTA
Reverse: AAAGGACAGCAGTTTCAAGT
GAPDHForward: AACCTGCCAAATATGATGAC
Reverse: TCATACCAGGAAATGAGCTT
β-ACTINForward: AAACTGGAACGGTGAAGGTG
Reverse: AGAGAAGTGGGGTGGCTTTT
CyclophilinForward: GCCATGGAGCGCTTTGG
Reverse: CCACAGTCAGCAATGGTGATC
NADH Fe-SForward: TTACTCCAAAGCCTGTTGTT
Reverse: CCACATAAATCACCATGACA
NADH α1Forward: AATTGGCGACTTCGATATTA
Reverse: CAGCACTGAAGTTGTTCAAA
NADH flavorForward: TCATGAATAAGCCCTCAGAT
Reverse: CACAAACACGTCAAAATCAT
NQO1 (64)Forward: GGAGTAAGAAGGCAGTGCTTTC
Reverse: GGCCAGAGAATGACATTCATGT
SOD2 (66)Forward: GCTTGTCCAAATCAGGATCCA
Reverse: GCGTGCTCCCACACATCA
OGG1 (66)Forward: ATTCCAAGGTGTGCGACTGCT
Reverse: GCGGGCGATGTTGTTGTT
GPX1Forward: AGTTTGGGCATCAGGAGAACG
Reverse: CAGGAAGGCGAAGAGAGGGT
  • CTGF, connective tissue growth factor; CPT1B, carnitine palmitoyltransferase 1B; CS, citrate synthase; FN, fibronectin; COLIα1, collagen I α1-subunit; COLIIIα1, collagen III α1; PORIN, porin; COX6, cytochrome C oxidase subunit 6; COX7, cytochrome C oxidase subunit 7; NRF1, nuclear respiratory factor 1; NRF2, nuclear respiratory factor 2; MtTFA, mitochondrial transcription factor A; PGC1α, peroxisome proliferative–activated receptor-γ coactivator 1α; PGC1β, peroxisome proliferative–activated receptor-γ coactivator 1β; GAPDH, glyceraldehyde phosphate dehydrogenase; β-ACTIN, β-actin; NADH Fe-S, NADH dehydrogenase iron-sulfur protein; NADHα1, NADH dehydrogenase α1 subunit; NADH flavo, NADH dehydrogenase flavoprotein subunit 1; NQO1, NAD(P)H quinone oxidoreductase; SOD2, superoxide dismutase 2; OGG1, 8-oxoguanine DNA glycosylase; GPX1, glutathione peroxidase 1. Where noted, primers were used as reported in the literature. Otherwise, primers were custom designed or, in the case of GPX1, courtesy of Dr. A. Civitarese.