TABLE 1

Primers and product size for real-time RT-PCR

Target genesGenBank accession no.Forward primerReverse primerProduct size (bp)
GapdhNM_017008.35′- GAGCTGAATGGGAAGCTCAC-3′5′-AAAGGTGGAGGAGTGGGAGT-3′216
β-actinNM_031144.25′-AGCCATGTACGTAGCCATCC-3′5′- CTCTCAGCTGTGGTGGTGAA−3′228
Vegf-aNM_031836.15′-AGAAACCCAATGAAGTGGTG-3′5′- ACTCCAGGGCTTCATCATTG-3′177
Flt-1NM_019306.15′- TCCCTCAGCCTACCATCAAG-3′5′- GAGAGTCAGCCACCACCAAT-3′207
Flk-1NM_013062.15′-ACAGCATCACCAGCAGTCAG-3′5′- CCAAGAACTCCATGCCCTTA-3′168
  • The pairs of primers were designed according to rat gene sequences published in GenBank.