TABLE 1

Nested and real-time PCR probe and primer sequences

Probe/primer nameSequenceLabels
EX4FP5’ TGCGTGTCTACAACTGGTTTG 3’None
EX9RP5’ AGGGTGGTGGCCTGAGAT 3’None
EX4FS5’ TGGCCATGGACACGTACAG 3’None
EX9RS5’ GTGAAGCCCGGACTCACTG 3’None
HNF1A-WT-F5’ CCCTCTCCCCCAGTAAGGT 3’None
HNF1A-WT-R5’ AGGGTACTTCTGCAGTCTCACT 3’None
HNF1A-WT-P5’ CACGGTGTGCGCTATG 3’5’ 6-FAM, 3’-MGB
G319S-FL-F5’ TGCCCTCTCCCCCAGTAAG 3’None
G319S-FL-R5’ AGGGTACTTCTGCAGTCTCACT 3’None
G319S-FL-P5’ TCCACAGTGTGCGCTATG 3’5’ 6-FAM, 3’-MGB
Ex412bpdel-F5’ CCTCCACCTGCCCTCTC 3’None
Ex412bpdel-R5’ AGGGTACTTCTGCAGTCTCACT 3’None
Ex412bpdel-P5’ CCCCAGTGTGCGCTATG 3’5’ 6-FAM, 3’-MGB
IVS4ins7-F5’ CTCCACCTGCCCTCTCC 3’None
IVS4ins7-R5’ TCGCAGGCTGTCCATAGC 3’None
IVS4ins7-P5’ ACCACTTACTGTGGACCTTA 3’5’ 6-FAM, 3’-MGB
Ex8del-F5’ CCCCTTCATGGCCACCAT 3’None
Ex8del-R5’ GTGTGAAGCCCGGACTCA 3’None
Ex8del-P5’ CCCCACGGTCTTCACC 3’5’ 6-FAM, 3’-MGB
  • The sequences of nested PCR primers and oligonucleotides used in the real-time quantification are given. The label 6-FAM refers to 6-fluorosceine and MGB refers to the minor groove binding non-fluorescent quencher. Forward primers are given by F suffix, reverse primers by R suffix, and probes by P suffix.