TABLE 1

SST and SSTR1–5 mRNA expression in control and Sst−/− islets

Primer sequenceProduct (bp)Tann (C°)mRNA expression
Sst+/+Sst−/−
SSTF: ccagactccgtcagtttc12456+
R: gctccagggcatcattct
SSTR1F: ttttgtcatctgctggatgc16759.9++
R: ggaaagagcgcttgaagttg
SSTR2F: acgccaagatgaagaccatc19755.7++
R: catgaccgtcaagcagaaga
SSTR3F: tggtgatctacgtggtcctg16359.9++
R: agacggcacatgagagatcc
SSTR4F: tgctaactgctggcatgaag15459.9++
R: ttcagcactgacaccaggag
SSTR5F: cgacttcgtacagcaatcca21358++
R: ctcacagaggttggctcaca
  • SST mRNA was detected by RT-PCR in control but not in Sst−/− mouse islet extracts, confirming the absence of endogenous δ-cell SST in Sst−/− mice. SSTR1–5 mRNAs were identified in both control and Sst−/− islet extracts. F, forward primer, R, reverse primer.