TABLE 2

Real-time RT-PCR probes and primers used for amplification of NF-κB p65 and IκBα in PBMCs

TargetProbeForward primer 5′–3′Reverse primer 5′–3′
NF-κB p656-FAM AGCTCAAGATCTGCCGCTCATCCCATCTTTGACAATCGTTGCACCTTGTCACACAGTAGGAA
IκBα6-FAM CTTCCAGAACAACCTGCAGGGAGACCTGGCCTTCCTTTCTGGCTGGTTGGTGATCA