TABLE 1

PCR primers for ObR isoforms and 18S

NameSense primer (5′-3′)Antisense primer (5′-3′)
ObRaAGGGCTGTATGTCATTGTACCCATAGTTTAGGTTTGTTTCCCTCCATC
ObRbACAGTTCTGGCTGTCAATTCCCAGGAGCTGCTAGAAAGACTG
ObRcACAGTTCTGGCTGTCAATTCCCGAAAGGATGAACAGGCTTGAGAAC
ObRdAGGGCTGTATGTCATTGTACCCATCTTCATGTAAAGATATATCCTTTTCC
ObReAGGGCTGTATGTCATTGTACCCATCCATGAAAAGTACAGTACACATACC
18SGGGAGGTAGTGACGAAAAATAACAATCATGGCCTCAGTTCCGAAA