TABLE 1

Primers for gene expression analysis by quantitative RT-PCR

GeneGeneBank Accession NumberForward (5′–3′)Reverse (5′–3′)Product length, bp
Mouse
 AdiponectinAF304466GGAACTTGTGCAGGTTGGATTCCTGTCATTCCAACATCTCC162
 MCP-1NM_011333CGGAACCAAATGAGATCAGAATGTGGAAAAGGTAGTGGATGC126
 GAPDHBC083149GGGTGTGAACCACGAGAAATAAGTTGTCATGGATGACCTTGG104
 TNF-αNM_013693CCAGTCTGTGTCCTTCTAATCTTGTGTTTCTGAGTAGTT93
 XORNM_011723TATGACCGCCTTCAGAACTATGCCTTCCACAGTTGT102
 β-ActinNM_007393GAGAGGTATCCTGACCCTGAAGTATGTTGAAGGTCTCAAACATGATCT203
Human
 AdiponectinNM_004797AAGGAGATCCAGGTCTTATTGCCCACACTGAATGCTGAG151
 MCP-1NM_002982TGTGCCTGCTGCTCATAGCTTGCTGCTGGTGATTCTTC150
 XORNM_000379TGGTGGATGCTGTGGAGGAGATGAAGATGGCGAGAGGCTGACTGAG86
 β-ActinNM_001101CGTGCGTGACATTAAGGAGAAGGAAGGAAGGCTGGAAGAG177
  • bp, base pairs.