TABLE 1

PCR primers

PrimerPPGCCKA receptorCCKB receptor
Outer primer
 ForwardATGAAGACCGTTTACATCGTGGCTCAGTGTGCTGGGGAACACGCTTCCTGGGACTGAGCCGACGC
 ReverseCTGGTGGCAAGGTTATCGAGAACCGTGTCATATGCCCGCCAGGAAGGCACGCCACGTGTTGG
Inner primer
 ForwardACCAAGAGGAACCGGAACTCTTCGGAAGTGCCGTGTGCAAGCCATCTGCCGACCACTGCAA
 ReverseCCAAGTTCCTCAGCTATGGCGCACTTGGCAACAGGAAGCGGCCCCCCTTGGTTTCGGACCCG
Product size (bp)
 Outer492886860
 Inner186285341