Table 1

Sequences of the PCR primers

GeneForward primer (5′–3′)Reverse primer (5′–3′)
mPGC-1αGCAGGTCGAACGAAACTGACaCTCAGCCTGGGAACACGTTAa
TCCTCCTCATAAAGCCAACCbGCCTTGGGTACCAGAACACTb
CTGCTCTGGTTGGTGAGGAcGCAGGCTCATTGTTGTACTGc
AGCCGTGACCACTGACAACGAGdGCTGCATGGTTCTGAGTGCTAAGd
PEPCKGGTGTTTACTGGGAAGGCATCCAATAATGGGGCACTGGCTG
mERRαATCTGCTGGTGGTTGAACCTGAGAAGCCTGGGATGCTCTTG
mCYCSCCAAATCTCCACGGTCTGTTCATCAGGGTATCCTCTCCCCAG
mATP5BGGTTCATCCTGCCAGAGACTAAATCCCTCATCGAACTGGACG
mVDRGAATGTGCCTCGGATCTGTGGGGTCATAGCGTTGAAGTGGAA
rCYP2R1AAACTACAACCAATGTGCTCCGCTTCCCAAGAAGGCCTCCTGT
18SCGCCGCTAGAGGTGAAATTCCCAGTCGGCATCGTTTATGG
TBPGAATATAATCCCAAGCGATTTGCACACCATTTTTCCAGAACTG
mPGC-1βCTCCAGGCAGGTTCAACCCGGGCCAGAAGTTCCCTTAGG
mGRAGCTCCCCCTGGTAGAGACGGTGAAGACGCAGAAACCTTG
mNR1D1TCCCCAAGAGAGAGAAGCAACTGAGAGAAGCCCACCAAAG
mTATTGCTGGATGTTCGCGTCAATACGGCTTCACCTTCATGTTGTC
mGAPDHGGTCATCATCTCCGCCCCTTCTCGTGGTTCACACCCATC
mG6PASECATCAATCTCCTCTGGGTGGTGCTGTAGTAGTCGGTGTCC
mCYP2R1Mm01159414_m1 (Life Technologies)
mCYP24A1Mm00487245_m1 (Life Technologies)
  • aUsed for measuring PGC-1α mRNA in Figs. 4C and 5G.

  • bUsed for measuring PGC-1α mRNA in Fig. 3A and E and Supplementary Fig. 2L.

  • cFor adenoviral expressed PGC-1α detection.

  • dUsed for measuring PGC-1α mRNA in Fig. 5C and Supplementary Fig. 2I.