Table 2

PCR and pyrosequencing primers and electrophoretic mobility shift assay probes

Forward primers (5′ to 3′)Reverse primers (3′ to 5′)Sequencing primers
CpG loci covered*
 CpG −783 to −841AAAGGTATTTTAAGGTAGTTAGGGAGGAAACCCCATCCTTTCAACTTCCTTCTA
 CpG −617 to −652TGTGGTTTGTTTTTTTTATATGGAGTAAAGTAAACAAACTCCTCCACCCAAAAT
 CpG −515 to −521GAATTTTGGGTGGAGGAGTATCTCCAAATAAACTCAAACTCAATT
 CpG −783 to −841ACTCCCAAAAAACAAATATTAATAA (3′ to 5′)
 CpG −617 to −652GGAGTAAAGAAAATTGTAGTAAT (5′ to 3′)
 CpG −515 to −521AAAAAAAAAAAAAAAAAAAAAAAGT (5′ to 3′)
Electrophoretic mobility shift assay
 Unmethylated probeGAGCAGAGCAGCAGCGACTGTATTTACTAACACTAGTGTTAGTAAATACAGTCGCTGCTGCTCTGCTC
 Methylated probeGAGCAGAGCAGCAGmeCGACTGTATTTACTAACACTAGTGTTAGTAAATACAGTmeCGCTGCTGCTCTGCTC
 Nonspecific competitorCCCCAGCCTCCCGGCGGGGTCACCCGGGTGACCCCGCCGGGAGGCTGGGG
 PBX1/Hoxb9 consensus sequenceATGATTTACGACGTCGTAAATCAT
  • *Position relative to transcription start site (bases).