Table 1

Primer sequences

Gene targetForwardSize (bases)ReverseSize (bases)
GapdhAGGTCGGTGTGAACGGATTTG21TGTAGACCATGTAGTTGAGGTCA23
18sCCCAACTTCTTAGAGGGACAAG22GCTTATGACCCGCACTTACT20
TbpGTTTCTGCGGTCGCGTCATTT21TGGGTTATCTTCACACACCATGAA24
Arg-1CTCCAAGCCAAAGTCCTTAGAG22AGGAGCTGTCATTAGGGACA20
iNosGTTCTCAGCCCAACAATACAAGA23GTGGACGGGTCGATGTCAC19
TnfCCAGACCCTCACACTCAGATC21CACTTGGTGGTTTGCTACGAC21
Il6TAGTCCTTCCTACCCCAATTTCC23TTGGTCCTTAGCCACTCCTTC21
IfngATGAACGCTACACACTGCATC21CCATCCTTTTGCCAGTTCCTC21
Col3a1ACGTAGATGAATTGGGATGCAG22GGGTTGGGGCAGTCTAGTG19
Pdgf-bbAAGTGTGAGACAATAGTGACCCC23CATGGGTGTGCTTAAACTTTCG22
Hsp70TGGAGATCATCGCCAACGACC21TCCTCCACGAAGTGGCTCACC21