Table 1

Sequences for real-time PCR primers

GeneForward (5′ to 3′)Reverse (5′ to 3′)
18S rRNACGAAAGCATTTGCCAAGAATAGTCGGCATCGTTTATGGTC
Glut1GACCCTGCACCTCATTGGGATGCTCAGATAGGACATCCAAG