Skip to main content
  • More from ADA
    • Diabetes Care
    • Clinical Diabetes
    • Diabetes Spectrum
    • ADA Standards of Medical Care in Diabetes
    • ADA Scientific Sessions Abstracts
    • BMJ Open Diabetes Research & Care
  • Subscribe
  • Log in
  • My Cart
  • Follow ada on Twitter
  • RSS
  • Visit ada on Facebook
Diabetes

Advanced Search

Main menu

  • Home
  • Current
    • Current Issue
    • Online Ahead of Print
    • ADA Scientific Sessions Abstracts
  • Browse
    • By Topic
    • Issue Archive
    • Saved Searches
    • ADA Scientific Sessions Abstracts
    • Diabetes COVID-19 Article Collection
    • Diabetes Symposium 2020
  • Info
    • About the Journal
    • About the Editors
    • ADA Journal Policies
    • Instructions for Authors
    • Guidance for Reviewers
  • Reprints/Reuse
  • Advertising
  • Subscriptions
    • Individual Subscriptions
    • Institutional Subscriptions and Site Licenses
    • Access Institutional Usage Reports
    • Purchase Single Issues
  • Alerts
    • E­mail Alerts
    • RSS Feeds
  • Podcasts
    • Diabetes Core Update
    • Special Podcast Series: Therapeutic Inertia
    • Special Podcast Series: Influenza Podcasts
    • Special Podcast Series: SGLT2 Inhibitors
    • Special Podcast Series: COVID-19
  • Submit
    • Submit a Manuscript
    • Submit Cover Art
    • ADA Journal Policies
    • Instructions for Authors
    • ADA Peer Review
  • More from ADA
    • Diabetes Care
    • Clinical Diabetes
    • Diabetes Spectrum
    • ADA Standards of Medical Care in Diabetes
    • ADA Scientific Sessions Abstracts
    • BMJ Open Diabetes Research & Care

User menu

  • Subscribe
  • Log in
  • My Cart

Search

  • Advanced search
Diabetes
  • Home
  • Current
    • Current Issue
    • Online Ahead of Print
    • ADA Scientific Sessions Abstracts
  • Browse
    • By Topic
    • Issue Archive
    • Saved Searches
    • ADA Scientific Sessions Abstracts
    • Diabetes COVID-19 Article Collection
    • Diabetes Symposium 2020
  • Info
    • About the Journal
    • About the Editors
    • ADA Journal Policies
    • Instructions for Authors
    • Guidance for Reviewers
  • Reprints/Reuse
  • Advertising
  • Subscriptions
    • Individual Subscriptions
    • Institutional Subscriptions and Site Licenses
    • Access Institutional Usage Reports
    • Purchase Single Issues
  • Alerts
    • E­mail Alerts
    • RSS Feeds
  • Podcasts
    • Diabetes Core Update
    • Special Podcast Series: Therapeutic Inertia
    • Special Podcast Series: Influenza Podcasts
    • Special Podcast Series: SGLT2 Inhibitors
    • Special Podcast Series: COVID-19
  • Submit
    • Submit a Manuscript
    • Submit Cover Art
    • ADA Journal Policies
    • Instructions for Authors
    • ADA Peer Review
OtherBrief Genetics Reports

5′ Flanking Variants of Resistin Are Associated With Obesity

James C. Engert, Marie-Claude Vohl, Scott M. Williams, Pierre Lepage, J C. Loredo-Osti, Janet Faith, Carole Doré, Yannick Renaud, Noël P. Burtt, Amélie Villeneuve, Joel N. Hirschhorn, David Altshuler, Leif C. Groop, Jean-Pierre Després, Daniel Gaudet, Thomas J. Hudson
DOI: 10.2337/diabetes.51.5.1629 Published 1 May 2002
James C. Engert
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Marie-Claude Vohl
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Scott M. Williams
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Pierre Lepage
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
J C. Loredo-Osti
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Janet Faith
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Carole Doré
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Yannick Renaud
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Noël P. Burtt
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Amélie Villeneuve
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Joel N. Hirschhorn
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
David Altshuler
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Leif C. Groop
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Jean-Pierre Després
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Daniel Gaudet
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site
Thomas J. Hudson
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Find this author on ADS search
  • Find this author on Agricola
  • Search for this author on this site

Abstract

Diabetes and obesity have long been known to be related. The recently characterized adipocyte hormone resistin (also called FIZZ3/ADSF) has been implicated as a molecular link between impaired glucose tolerance (IGT) and obesity in mice. A search for sequence variants at the human resistin locus identified nine single-nucleotide polymorphisms (SNPs) but no coding variants. An investigation into the association of these SNPs with diabetes and obesity revealed two 5′ flanking variants (g.-537 and g.-420), in strong linkage disequilibrium, that are associated with BMI. In nondiabetic individuals from the Quebec City area and the Saguenay-Lac-St-Jean region of Quebec, the g.-537 mutation (allelic frequency = 0.04) was significantly associated with an increase in BMI (P = 0.03 and P = 0.01, respectively). When the data from these two populations were combined and adjusted for age and sex, both the g.-537 (odds ratio [OR] 2.72, 95% CI 1.28–5.81) and the g.-420 variants (1.58, 1.06–2.35) were associated with an increased risk for a BMI ≥30 kg/m2. In contrast, in case/control and family-based study populations from Scandinavia, we saw no effect on BMI with either of these promoter variants. No association was seen with diabetes in any of the population samples.

Approximately 80% of type 2 diabetic subjects are overweight or obese. The growing rate of obesity (1,2) is thought to directly impact the increasing prevalence of type 2 diabetes in North America (3). Recently, the hormone resistin (accession no. NM_020415) has been postulated to play a role at the nexus of these two complex traits (4). Resistin belongs to a family of secreted peptides (5,6) that shares a cysteine-rich COOH-terminus and forms disulfide-linked homodimers (7). Resistin was identified in the mouse by screening differentiated adipocytes for genes repressed by the antidiabetic drug rosiglitazone, a member of the class of insulin-sensitizing drugs known as thiazolidinediones (TZDs), which are thought to target peroxisome proliferator-activated receptor (PPAR)-γ (rev. in 8). Mouse resistin is expressed exclusively in adipocytes (4,9) and inhibits their differentiation in culture (9). Circulating levels of resistin are increased after high-carbohydrate meals (9) and in genetically and diet-induced obesity (4). In mice fed a high-fat diet, anti-resistin antibodies improve blood glucose and insulin action (4). Human resistin is expressed only at low levels in adipose tissue (10,11), and its contribution to these disease states is unclear.

Previous work demonstrated that the Pro12Ala variant of PPAR-γ affects susceptibility to diabetes (12 and refs. therein). Because PPAR-γ is thought to be a target for TZDs, we reasoned that polymorphisms in the resistin gene, whose expression appears to be regulated by TZDs in mice (4,13,14), might show a similar association with these related disorders. Therefore, we examined resistin for coding and noncoding variants. In the polymorphism discovery phase of this study, all exons, the exon-intron boundaries, and 472 bp of the 5′ flanking region of resistin were resequenced in 45 individuals from two study populations (15,16) representing a sample of diabetic, obese, and control individuals. In this phase of the study, seven variants were found: one substitution in the 3′ UTR (c.*62G>A), two single-nucleotide polymorphisms (SNPs) in intron 2 (IVS2 + 39C>T and IVS2 + 181G>A), two SNPs in intron 3 (IVS3 + 30C>T and IVS3-16C>G), and two SNPs in the 5′ flanking region (g.-537A>C and g.-420C>G) (Fig. 1). Two polymorphisms were previously described (c.*62G>A and IVS2 + 39C>T) (17), and one (g.-420C>G) had been identified by the SNP Consortium (GenBank reference SNP no. 1862513). Because the two promoter polymorphisms are in close proximity, we elected to genotype them by sequencing genomic DNA. Two more rare 5′ flanking SNPs were identified in subsequent samples (g.-638G>A and g.-358G>A) (Fig. 1). These two SNPs appear to be in perfect linkage disequilibrium (LD), with the minor alleles present in the same 11 heterozygotes among 590 Quebec individuals.

As no coding variants were found and promoter variants are likely to play an important role in complex traits, we elected to first study the promoter SNPs for a possible relationship with diabetes or BMI. An association study was initiated to examine the two more common 5′ flanking SNPs (g.-537A>C and g.-420C>G) in a type 2 diabetic case/control sample from the Saguenay-Lac-St-Jean (SLSJ) region of Quebec and a population sample of men from the Quebec City (QC) area. Genotype distributions for these two variants did not differ significantly from Hardy-Weinberg equilibrium in either the QC or SLSJ case/control sample. In addition, allelic frequencies in these two study samples were not significantly different. To assess the association of the g.-537A>C and g.-420C>G polymorphisms with type 2 diabetes, we compared allele frequencies of these variants in the case/control study sample of diabetic and nondiabetic subjects recruited from the SLSJ area. As shown in Table 1, no difference in allele frequencies was observed between type 2 diabetic and nondiabetic subects. In a logistic regression model that included age and sex, neither the resistin g.-537A>C polymorphism nor the g.-420C>G polymorphism were significant contributors to diabetes (data not shown).

In the QC sample, an increase in BMI (30.4 vs. 29.2 kg/m2, P = 0.03) was associated with the presence of the g.-420 G allele compared with the C/C genotype (Fig. 2A). Similarly, we found an association with the presence of the g.-537 C allele compared with the A/A genotype for BMI (31.8 vs. 29.7 kg/m2), which was also significant (P = 0.03) (Fig. 2B), despite the low frequency (3.9%) of this allele. In addition, several indices of obesity were significantly associated with the G allele at g.-420: weight (92.8 vs. 87.9 kg, P = 0.006), body fat mass (27.8 vs. 25.4 kg, P = 0.03), and waist circumference (102.9 vs. 100.0 cm, P = 0.04) (Table 2). All of these same parameters were affected by the C allele at position g.-537. All differences remained statistically significant after adjustment for age (data not shown).

Because we observed an association of the g.-537 and c.-420 alleles with BMI in the QC sample, these alleles were analyzed in the SLSJ diabetic and nondiabetic subjects for their association with BMI. No association was observed between either of the polymorphisms and BMI in the whole study population (data not shown), but there was a statistically significant effect for carriers of the g.-537 C allele when only women were examined (P = 0.03) (Fig. 2B). Waist circumference was also significantly higher in these women (90.9 vs. 86.4 cm, P = 0.01). We also found a significantly higher BMI in carriers of the g.-537 C allele (P = 0.01), when only the nondiabetic subgroup of the SLSJ study population was examined (Fig. 2A). The most significant association of BMI and genotype was observed when combining all nondiabetic subjects from both studies, with both g.-420G and g.-537C significant at P = 0.017 and P = 0.001, respectively (Figs. 2A and B). All differences remained significant after adjustment for age (data not shown). In addition, in a family-based population sample from SLSJ that had some overlap with the case/control sample, a quantitative transmission disequilibrium test (QTDT) showed a significant contribution of the g.-537C allele to a higher BMI when age and sex were included in the model (P = 0.039). We note that as this family-based cohort contained some of the same individuals as the SLSJ case/control sample, this does not constitute an independent replication.

Using logistic regression analyses, we calculated odds ratios (ORs) for a BMI >30 kg/m2. There was a strong agreement between the OR for the QC and the SLSJ study samples when only nondiabetic individuals were examined. For both of these groups, the OR was >1.5 for the g.-420G variant and >2.7 for the g.-537C variant (Table 3). Finally, for all nondiabetic subjects combined, the ORs for the G allele at g.-420C>G and the C allele at g.-537A>C are 1.58 (CI 1.06–2.35, P = 0.025) and 2.72 (1.28–5.81, P = 0.01), respectively, when age and sex are included in the model (Table 3).

The g.-420 G and the g.-537 C alleles are in significant LD with each other. In the 590 Quebec individuals studied thus far, the C allele at position g.-537 is present only in individuals bearing the G allele at position g.-420. We observed that the average BMI of those nondiabetic individuals possessing the C allele at position g.-537 (and thus possessing both variants) was higher than those possessing only the G allele at position g.-420 (P = 0.006).

It is possible that either of these 5′ polymorphisms may change a transcription factor binding site affecting resistin mRNA levels. A search for potential binding sites at positions g.-420 and g.-537 with MatInspector V2.2 (18) revealed several transcription factor motifs altered by these variant alleles (e.g., an AP1 site is destroyed by g.-537A>C). Although the precise mechanisms controlling resistin transcription remain to be elucidated, one report has implicated the β-adrenergic receptors and protein kinase A in decreased resistin expression (19).

We attempted to replicate our finding in Scandinavian study populations. There was no significant association between the two resistin promoter variants and obesity in these previously described (12) study populations, which included a diabetes case/control sample (Table 1), diabetic trios, and normal glucose tolerant trios (QTDT, data not shown). In the case of g.-537, this may be because the rare allele had a frequency of 0.02 in the Scandinavian case/control sample, significantly lower than the 0.04 observed in Quebec (P = 0.005, Fisher’s exact test) (Table 1). Three other alternatives may explain the lack of replication for the promoter variants: 1) interacting loci or environmental conditions differ between these two populations and influence the phenotypic expression of the variants; 2) resistin polymorphisms from Quebec are in LD with another functional variant in this or another gene, whereas the Scandinavian sample could be in linkage equilibrium with this other mutation; or 3) the finding in the Quebec populations is spurious.

At present, very little is known about the function of resistin in humans, and the expression level in human adipose tissue remains controversial (10,11,20,21). However, Savage et al. (11) detected resistin more often in the fat of the morbidly obese than in normal control subjects, and McTernan et al. (20) found an increase in resistin in abdominal fat compared with thigh. Our results demonstrate an increased risk for higher BMI for carriers of two resistin promoter polymorphisms among French Canadians in Quebec. Interestingly, the observed effect appears to be strongest in nondiabetic subjects. In nondiabetic subjects, a change in the level of resistin may contribute to obesity, possibly as a result of misregulated transcription that has other physiological consequences in diabetic subjects. Alternatively, the basal or activated transcription of resistin in diabetic subjects may be different. Measuring levels of resistin in individuals with these variants could contribute to the characterization of the resistin promoter. The increased risk for obesity conferred by the resistin variants in these populations warrants additional studies in larger population samples.

RESEARCH DESIGN AND METHODS

Population samples.

The diabetes case/control sample (n = 359, mean age 52.0 years) is described elsewhere (15). Briefly, the study population consisted of newly diagnosed type 2 diabetic subjects (1998 World Health Organization criteria) (22) from the SLSJ and age- and sex-matched control subjects (normal glucose tolerant). Some individuals were also enrolled in a family-based study of 79 families (424 individuals). The QC sample, comprised of 231 men (mean age 42.4 years) and selected for a wide range of adiposity, was previously described (16). Briefly, these subjects were sedentary, nonsmoking, and free of metabolic disorders requiring treatment, such as diabetes or hypertension. The Scandinavian case/control sample (n = 968, mean age 60.5 years) and family-based study populations are described elsewhere (12). Briefly, case subjects had either diabetes or severe IGT, and control subjects were matched for sex, age, and geographic location. The Scandinavian family-based study populations were based on trios in which offspring had either type 2 diabetes (n = 126), IGT (n = 108), impaired fasting glucose (n = 99), or normal glucose tolerance (n = 379). Patients gave informed consent, and research protocols were monitored by local institutional review boards.

Sequencing.

Primer annealing temperatures were 56–60°C. PCR conditions were 50 ng genomic DNA, 1.25 units Qiagen HotStart Taq (Qiagen, Mississauga, Ontario, Canada) (1.5 mmol/l MgCl2,), 0.2 mmol/l dNTPs, and 0.4 μmol/l primers in a 50-μl reaction. PCR products were purified (Mulitiscreen; Millipore, Bedford, MA), and sequencing was performed using BigDye Terminator (version 2.0) and analyzed on ABI 3700 sequencers (Applied BioSystems, Foster City, CA). Data were processed using Sequencing Analysis software (version 3.6) and then aligned with Autoassembler 2.1 (Applied BioSystems). All exons, the exon-intron splicing boundaries, and the promoter of resistin were screened (see below for primers) by sequencing two Centre d’Etude du Polymorphisme Humain (CEPH) individuals and 45 individuals from SLSJ and QC, consisting of obese and nonobese patients (either nondiabetic or type 2 diabetic subjects). PCR products exhibited the expected lengths, consistent with the absence of deletions, duplications, or rearrangements.

Resistin sequencing primers.

Primers were as follows: promoter F: tgtcattctcacccagagaca; promoter R: tgggctcagctaaccaaatc; exon 1–2F: gggacttattagccaagcca; exon 1–2R: tgggttggagtcaggtctgt. Intron 2F: gagaggatccaggaggtcg; intron 2R: aggtgacgctctggcact. Exon 3F: acagggctaggggaggatg; exon 3R: agtagaggctggacacggg. Exon 4F: cctcagcctcccagctca; exon 4R: agacgctagatcagtccctcc.

Statistical methods.

Allele frequency and genotype distribution comparisons were assessed using the algorithms of Raymond and Rousset (23). Hardy-Weinberg analyses were performed based on Weir’s algorithm (24), using Genetic Data Analysis (GDA) Version 1.0 (d12) by P.O. Lewis and D. Zaykin, available at http://lewis.eeb.uconn.edu/lewishome/gda.html.

Before analyses, distributions for BMI, weight, body fat mass, waist circumference, and abdominal adipose tissue (from computed tomography) were tested for skewness and kurtosis, and all variables were below one and four, respectively. Mean anthropometric values were compared between genotype classes using Student’s t test. ANCOVA was used to adjust anthropometric variables for age. Logistic regression analyses were performed on the dependent variable, obesity, defined as BMI ≥30 kg/m2 for obese versus BMI <30 kg/m2 for nonobese subjects. ORs were adjusted for age and sex. Statistical analyses were performed with the SAS statistical package (SAS Institute, Cary, NC). All P values presented are nominal, as no corrections were made for multiple testing. The QTDTs were performed with the software QTDT version 2.2.1 (available at http://www.well.ox.ac.uk/asthma/QTDT), using an orthogonal association model (25).

FIG. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIG. 1.

SNPs in resistin. Schematic representation of the human resistin (FIZZ3) gene locus and exon structure and location of eight SNPs. Minor allele frequencies derived from all Quebec samples assayed are in parentheses (based on >300 samples for all SNPs except IVS3 + 30, which is based on 45 samples). SNP numbering is based on GenBank accession no. AF205952.

FIG. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
FIG. 2.

Average BMI by genotype for g.-420 (A) and g.-537 (B). A: •, CC genotype; ○, CG and GG genotypes combined. B: •, AA genotype; ○, AC and CC genotypes combined. Error bars = SE of the mean. P values from Student’s t test are shown above each comparison. DBT, diabetic; all non-DBT, all nondiabetic subjects from SLSJ combined with the QC samples.

View this table:
  • View inline
  • View popup
TABLE 1

Genotype frequencies of 5′ flanking SNPs at the resistin locus

View this table:
  • View inline
  • View popup
TABLE 2

Subjects’ characteristics by genotype in the QC sample of nondiabetic men

View this table:
  • View inline
  • View popup
TABLE 3

Logistic regression analyses for BMI >30 kg/m2 for 5′ flanking SNPs at the resistin locus

Acknowledgments

This study was partly funded by a research contract from Bristol-Myers Squibb, Millennium Pharmaceuticals, and Affymetrix. The Scandinavian study was supported by a grant from the Sigrid Jueslius Foundation. J.C.E. is a recipient of an National Institutes of Health (NIH) postdoctoral fellowship. M.-C.V. is a research scholar from the Fonds pour la Formation des Chercheurs et l’Aide à la Recherche. S.M.W. received salary support from the NIH. JC.L.-O. was supported by the Montreal General Hospital Research Institute/Mathematics of Information Technology and Complex Systems (Network of Centres of Excellence) postdoctoral research fellowship. J.N.H. is the recipient of a Howard Hughes Medical Institute Postdoctoral Fellowship for Physicians and a Burroughs Wellcome Career Award in the Biomedical Sciences. J.P.D. is chair professor of human nutrition, lipidology, and prevention of cardiovascular disease, supported by Provigo and Pfizer Canada. D.G. is the chairholder of the Canadian Research Chair in preventive genetics and community genomics. T.J.H. is the recipient of a Canadian Institutes of Health Research clinician scientist award.

We thank the individuals who volunteered to participate in the studies in both Quebec and Scandinavia as well as the staff of the Montreal Genome Center, the Lipid Research Center in QC, and the Lipid Research Group at Chicoutimi Hospital. We also thank L. Coderre, R. Sladek, T. Pastinen, C. Greenwood, M. Fujiwara, N. Roslin, K. Morgan, E. Lander, and L. Pérusse for helpful discussions.

Footnotes

  • Address correspondence and reprint requests to Dr. Thomas J. Hudson or Dr. James C. Engert, Montreal Genome Centre, MGHRI/MUHC, Montréal, Québec, Canada H3G 1A4. E-mail: tom.hudson{at}mcgill.ca or jamie.engert{at}staff.mcgill.ca.

    Received for publication 12 November 2001 and accepted in revised form 22 January 2002.

    D.A. is a member of the Clinical Genomics Advisory Board at Merck Research Labs, a company that markets drugs used to treat diabetes. He is also a member of the Scientific Advisory Board of Genomics Collaborative, a company that performs diabetes research. Neither company was involved in the research described in this study. T.J.H. has received grant/research support from Bristol-Myers Squibb, Millennium Pharmaceuticals, and Affymetrix. Part of this grant support was used to fund this research.

    *J.C.E., M.-C.V., and S.M.W. contributed equally to this study.

    J.C.E., M.-C.V., and S.M.W. contributed equally to this study.

    IGT, impaired glucose tolerance; LD, linkage disequilibrium; OR, odds ratio; PPAR, peroxisome proliferator-activated receptor; QC, Quebec City; QTDT, quantitative transmission disequilibrium test; SLSJ, Saguenay-Lac-St-Jean; SNP, single-nucleotide polymorphism; TZD, thiazolidinedione.

  • DIABETES

REFERENCES

  1. Mokdad AH, Serdula MK, Dietz WH, Bowman BA, Marks JS, Koplan JP: The spread of the obesity epidemic in the United States, 1991–1998. JAMA1999 282 : 1519 –1522
  2. Flegal MD, Carroll RJ, Kuczmarski RJ, Johnson CL: Overweight and obesity in the United States: prevalence and trends, 1960–1994. Int J Obes Relat Metab Disord1998 22 : 39 –47
  3. Burton BT, Foster WR, Hirsch J, VanItallie TB: Health implications of obesity: NIH consensus development conference: Int J Obes Relat Metab Disord1985 9 : 155 –169
  4. Steppan CM, Bailey ST, Bhat S, Brown EJ, Banerjee RR, Wright CM, Patel HR, Ahima RS, Lazar MA: The hormone resistin links obesity to diabetes. Nature2001 409 : 307 –312
  5. Holcomb IN, Kabakoff RC, Chan B, Baker TW, Gurney A, Henzel W, Nelson C, Lowman HB, Wright BD, Skelton NJ, Frantz GD, Tumas DB, Peale FV, Shelton DL, Hebert CC: FIZZ1, a novel cysteine-rich secreted protein associated with pulmonary inflammation, defines a new gene family. EMBO J2000 19 : 4046 –4055
  6. Steppan CM, Brown EJ, Wright CM, Bhat S, Banerjee RR, Dai CY, Enders GH, Silberg DG, Wen X, Wu GD, Lazar MA: A family of tissue-specific resistin-like molecules. Proc Natl Acad Sci U S A2001 98 : 502 –506
  7. Banerjee RR, Lazar MA: Dimerization of resistin and resistin-like molecules is determined by a single cysteine. J Biol Chem2001 276 : 25970 –25973
  8. Spiegelman BM: PPAR-γ: adopogenic regulator and thiazolidinedione receptor. Diabetes1998 47 : 507 –514
  9. Kim KH, Lee K, Moon YS, Sul HS: A cysteine-rich adipose tissue-specific secretory factor inhibits adipocyte differentiation. J Biol Chem2001 276 : 11252 –11256
  10. Nagaev I, Smith U: Insulin resistance and type 2 diabetes are not related to resistin expression in human fat cells or skeletal muscle. Biochem Biophys Res Commun2001 285 : 561 –564
  11. Savage DB, Sewter CP, Klenk ES, Segal DG, Vidal-Puig A, Considine RV, O’Rahilly S: Resistin/fizz3 expression in relation to obesity and peroxisome proliferator-activated receptor-gamma action in humans. Diabetes2001 50 : 2199 –2202
  12. Altshuler D, Hirschhorn JN, Klannemark M, Lindgren CM, Vohl MC, Nemesh J, Lane CR, Schaffner SF, Bolk S, Brewer C, Tuomi T, Gaudet D, Hudson TJ, Daly M, Groop L, Lander ES: The common PPARgamma Pro12Ala polymorphism is associated with decreased risk of type 2 diabetes: Nat Genet2000 26 : 76 –80
  13. Moore GB, Chapman H, Holder JC, Lister CA, Piercy V, Smith SA, Clapham JC: Differential regulation of adipocytokine mRNAs by rosiglitazone in db/db mice. Biochem Biophys Res Commun2001 286 : 735 –741
  14. Way JM, Gorgun CZ, Tong Q, Uysal KT, Brown KK, Harrington WW, Oliver WR Jr, Willson TM, Kliewer SA, Hotamisligil GS: Adipose tissue resistin expression is severely suppressed in obesity and stimulated by peroxisome proliferator-activated receptor gamma agonists. J Biol Chem2001 276 : 25651 –25653
  15. Vohl MC, Lepage P, Gaudet D, Brewer CG, Bétard C, Perron P, Houde G, Cellier C, Faith JM, Després JP, Morgan K, Hudson TJ: Molecular scanning of the human PPARa gene: association of the L162v mutation with hyperapobetalipoproteinemia. J Lipid Res20002001 41 : 945 –952
  16. Vohl MC, Lamarche B, Pascot A, Leroux G, Prud’homme D, Bouchard C, Nadeau A, Després JP: Contribution of the cholesteryl ester transfer protein gene TaqIB polymorphism to the reduced plasma HDL-cholesterol levels found in abdominal obese men with the features of the insulin resistance syndrome. Int J Obes Relat Meta Disord1999 23 : 918 –925
  17. Cao H, Hegele RA: Single nucleotide polymorphisms of the resistin (RSTN) gene. J Hum Genet 46 : 553 –555
  18. Quandt K, Frech K, Karas H, Wingender E, Werner T: MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Research1995 23 : 4878 –4884
  19. Fasshauer M, Klein J, Neumann S, Eszlinger M, Paschke R: Isoproterenol inhibits resistin gene expression through a G(S)-protein-coupled pathway in 3T3-L1 adipocytes. FEBS Lett2001 500 : 60 –63
  20. McTernan CL, McTernan PG, Harte AL, Levick PL, Barnett AH, Kumar S: Resistin, central obesity, and type 2 diabetes (Letter). Lancet2002 359 : 46 –47
  21. Janke J, Engeli S, Gorzelniak K, Luft FC, Sharma AM: Resistin gene expression in human adipocytes is not related to insulin resistance. Obes Res2002 10 : 1 –5
  22. Alberti KGMM, Zimmet PZ: Definition, diagnosis and classification of diabetes mellitus and its complications. 1. Diagnosis and classification of diabetes mellitus: provisional report of a WHO consultation. Diabet Med1998 15 : 539 –553
  23. Raymond M, Rousset F: An exact test for population differentiation. Evolution1995 49 : 1280 –1283
  24. Weir BS: Genetic Data Analysis II. Sunderland, MA, Sinauer Associates,1996 , p. 91 –138
  25. Abecasis GR, Cardon LR, Cookson WO: A general test of association for quantitative traits in nuclear families. Am J Hum Genet2000 66 : 279 –292

Navigate

  • Current Issue
  • Online Ahead of Print
  • Scientific Sessions Abstracts
  • Collections
  • Archives
  • Submit
  • Subscribe
  • Email Alerts
  • RSS Feeds

More Information

  • About the Journal
  • Instructions for Authors
  • Journal Policies
  • Reprints and Permissions
  • Advertising
  • Privacy Policy: ADA Journals
  • Copyright Notice/Public Access Policy
  • Contact Us

Other ADA Resources

  • Diabetes Care
  • Clinical Diabetes
  • Diabetes Spectrum
  • Scientific Sessions Abstracts
  • Standards of Medical Care in Diabetes
  • BMJ Open - Diabetes Research & Care
  • Professional Books
  • Diabetes Forecast

 

  • DiabetesJournals.org
  • Diabetes Core Update
  • ADA's DiabetesPro
  • ADA Member Directory
  • Diabetes.org

© 2021 by the American Diabetes Association. Diabetes Print ISSN: 0012-1797, Online ISSN: 1939-327X.